circad | circRNAs associated with diseases

Circular RNA cTFRC
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Bladder Cancer	ICD-10	Malignant neoplasm of Bladder, unspecified (C67.9)
DBLink	Link to database	PMID	30782157
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Primary human BC and paired adjacent normal bladder tissues were obtained from patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCTGTCCAGCAGCCATAGG Reverse TCATTCTGAACTGCCACACAGA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Su, H, Tao, T, Yang, Z, Kang, X, Zhang, X, Kang, D, Wu, S, Li, C (2019). Circular RNA cTFRC acts as the sponge of MicroRNA-107 to promote bladder carcinoma progression. Mol. Cancer, 18, 1:27.