Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
Circular RNA cTFRC | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Bladder Cancer | ICD-10 | Malignant neoplasm of Bladder, unspecified (C67.9) |
DBLink | Link to database | PMID | 30782157 |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | Primary human BC and paired adjacent normal bladder tissues were obtained from patients |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGCTGTCCAGCAGCCATAGG ReverseTCATTCTGAACTGCCACACAGA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Su, H, Tao, T, Yang, Z, Kang, X, Zhang, X, Kang, D, Wu, S, Li, C (2019). Circular RNA cTFRC acts as the sponge of MicroRNA-107 to promote bladder carcinoma progression. Mol. Cancer, 18, 1:27. |